Офтальмик в linked in Офтальмик в твиттере Офтальмик вконтакте Статистика сайта Офтальмик.ру
Генетическая диагностика глазных болезней
.:: Новости ::: О компании ::: Услуги ::: Цены ::: Гены ::: Пациентам ::: Лечение ::: FAQ ::: Контакты ::. 
 
Диагностируем:
· Катаракта
· Глаукома
· Макулярная дегенерация
· Близорукость
· Пигментный ретинит
· Дистрофии сетчатки
· Дистрофии роговицы
· Увеиты
· Ретинобластома
· Амавроз Лебера
· Микрофтальм
· Анофтальм
· Аксенфельда-Ригера
· Ваарденбурга синдром
· Ретиношизис
· Косоглазие
· Выезд окулиста на дом
· Синдром Ашера
· Редкие болезни
 
 
Обучение
· Конференции
· Книги по офтальмогенетике
· Книга О.В. Хлебниковой Наследственная патология органа зрения
· Методы исследования в офтальмологии
· Классификация наследственных болезней сетчатки
· Критерии клинической классификации
· Форум по молекулярной медицине 2013
· Анализ геномных NGS данных
 
 
Пороки развития
· размеров и формы глаза
· придаточного аппарата
· роговицы
· сосудистой оболочки глаза
· хрусталика
· сетчатки
· зрительного нерва
· МУТАНТНЫЕ БЕЛКИ
 
 
Типы диагностики
· CLIA - что это?
· Кариотипирование
· FISH анализ
· SKY тест
· SSDGE или SSCP
· DGGE
· RFLPs
· Специфичный микрочип
· Типичный микрочип
· Прямое секвенирование
 
 
Панели тестов
· Панель "цилиопатии"
· Панель "пигментный ретинит"
· Панель "все глазные заболевания"
· Животные модели
· Пигментный ретинит: новости 2013
· Метаболизм сетчатки
· Дегенерация сетчатки и клеточная биология
 
 

Ген CNGA3 - дистрофии сетчатки

 

располагается на 2 хромосоме (локус 2q11.2)

с него считывается белок ионного канала: циклический нуклеотид вентильный канал альфа 3 (Cyclic Nucleotide Gated channel Alpha 3)

этот ген имеет синонимы: ACHM2, CCNC1, CCNCa, CCNCalpha, CNCG3, CNG3

Управляемый циклическими нуклеотидами канал альфа 3. Этот ген кодирует представителя семейства белков управляемого циклическими нуклеотидами канала, которое требуется для нормальной трансдукции зрительного и обонятельного сигнала. Мутации в этом гене ассоциированы с ахроматопсией (палочковым монохроматизмом) и цветовой слепотой. Два варианта альтернативного сплайсинга, кодирующие различные изоформы, были найдены для этого гена.

 

Мутации в гене CNGA3 приводят к развитию дистрофии сетчатки, ахроматопсии

Экзоны:

1. GCTTACTCATCCAGTGTGGATTACACTACCAGC AAAACATCCCAGGAAGGAGTCCAGGGT GGCCGCCCACAGTTAGGAGAGAACCCAGAACGGAACGACGGACTTGTTTGCTTTCTTGCC CCTGACTCTCCCCGTCCTCCCTGGGAGGGTTGGGGATGTGAACTAATGACTTCTGCCTCT TTCGGACCGCCTTTGAGGCTCCAGAGCCTCACCTTACTTTCCCACGGAGAGGGAGGCCAC AGGCTCCTTCAGCAGTCGCCGAGCAGAGTCCTGGGCCGGGAGCGCGGGGGAGGGAGCGAG CGGAACTGCGCCTAGGAGGCCGAGGGAGGAGGCGCTCCGCAGACCCTGGCGCGCCGCGGA GAAGCTCAAACTTTGGCAGG

2. AG CAATCATCTGGGGGGCTAAATGTGACAAACCGAGAA GATGGCCAAGATCAACACCCAATACTCCCACCCCTCCAGGACCCACCTCAAGGTAAAGAC CTCAGACCGAGATCTCAATCGCGCTGAAAATGGCCTCAGCAG

3. GAAGATG AAATTCAGTAGGCGAGAAGTGTTGGAACCAAAATCCTCGTTCTGGAGTCATTTTATGGAA GCAGCTGCTTTGGCTTGAAATG

4. AGCCCACTCGTCAAGTGAGGAGACATCG TCAGTGCTGCAGCCGGGGATCGCCATGGAGACCAGAGGACTGGCTGACTCCGGGCAGGGC TCCTTCACCGGCCAGGGGATCGCCAG (4 и 5 секвенировать вместе)

5. GTTTGGAAGAATTCAGA AAAAAAGCCAACCGGAGAAGGTGGTAAGAGCAGCCAGCCGTGGGAGACCTTTGATTGGGT GGACACAGTGGTGTGCTGAGGATGGTGGTGATGAGTCTGAAATGGCTCTGGCAGGGTCTC CCGGGTGCTCGTCTGGACCCCAGGGCAG

6. ACAAATGGTAATAAAGAGAGTGTCCCTTTCCGGG GAAGCCTGCCCCTGACTGCAGGGTGGAGGGAGAAGGGGATAAACGGTCCCCATGGGGCAG AGATGCAAACTTAGACCACAGGGCCCCCAGCACCCGTACCCTGCTGGTCATCATTGCTTC TGCCCCATCCCTTGAGACAGACAGAGAGGGAGGGAGAAAGAGAGAGAGGGAAAGACTGGG GTTTGGGGGTGTGGGGGGCTTTTCCTCTCCCTCTGGCTCAGTGCTTGTGTCACCTTCCAG GCTGTCGCGCCTCATCTTCTTGCTGCGCAGGTGGGCTGCCAGGCATGTGCACCACCAGGA CCAGGGACCGGACTCTTTTCCTGATCGTTTCCGTGGAGCCGAGCTTAAGGAGGTGTCCAG CCAAGAAAGCAATGCCCAGGCAAATGTGGGCAGCCAGGAGCCAGCAGACAGAGGGAGAAG

7. CGCCTGGCCCCTGGCCAAATGCAACAC TAACACCAGCAACAACACGGAGGAGGA

8. GAAGAAGACGAAAAAGAAGGATGCGATCGTGGTGGACCCGTCCAGCAACCTGTACTA CCGCTGGCTGACCGCCATCGCCCTGCCTGTCTTCTATAACTGGTATCTGCTTATTTGC AG

9. GGCCTGTTTCG ATGAGCTGCAGTCCGAGTACCTGATGCTGTGGCTGGTCCTGGACTACTCGGCAGATGTCC TGTATGTCTTGGATGTGCTTGTACGAGCTCGGACAG

10. GTTTTCTCGAGCAAGGCTTAATGGTCAGTGATACCAACAGGCTGTGGCAGC ATTACAAGACGACCACGCAGTTCAAGCTGGATGTGTTGTCCCTGGTCCCCACCGACCTGG CTTACTTAAAGGTGGGCACAAACTACCCAGAAGTGAGGTTCAACCGCCTACTGAAGTTTT CCCGGCTCTTTGAATTCTTTGACCGCACAGAGACAAGGACCAACTACCCCAATATGTTCA GGATTGGGAACTTGGTCTTGTACATTCTCATCATCATCCACTGGAATGCCTGCATCTACT TTGCCATTTCCAAGTTCATTGGTTTTGGGACAGACTCCTGGGTCTACCCAAACATCTCAA TCCCAGAGCATGGGCGCCTCTCCAGGAAGTACATTTACAGTCTCTACTGGTCCACCTTGA CCCTTACCACCATTGGTGAGACCCCACCCCCCGTGAAAGATGAGGAGTATCTCTTTGTGG TCGTAGACTTCTTGGTGGGTGTTCTGATTTTTGCCACCATTGTGGGCAATGTGGGCTCCA TGATCTCGAATATGAATGCCTCACGGGCAGAGTTCCAGGCCAAGATTGATTCCATCAAGC AGTACATGCAGTTCCGCAAGGTCACCAAGGACTTGGAGACGCGGGTTATCCGGTGGTTTG ACTACCTGTGGGCCAACAAGAAGACGGTGGATGAGAAGGAGGTGCTCAAGAGCCTCCCAG ACAAGCTGAAGGCTGAGATCGCCATCAACGTGCACCTGGACACGCTGAAGAAGGTTCGCA TCTTCCAGGACTGTGAGGCAGGGCTGCTGGTGGAGCTGGTGCTGAAGCTGCGACCCACTG TGTTCAGCCCTGGGGATTATATCTGCAAGAAGGGAGATATTGGGAAGGAGATGTACATCA TCAACGAGGGCAAGCTGGCCGTGGTGGCTGATGATGGGGTCACCCAGTTCGTGGTCCTCA GCGATGGCAGCTACTTCGGGGAGATCAGCATTCTGAACATCAAGGGGAGCAAGTCGGGGA ACCGCAGGACGGCCAACATCCGCAGCATTGGCTACTCAGACCTGTTCTGCCTCTCAAAGG ACGATCTCATGGAGGCCCTCACCGAGTACCCCGAAGCCAAGAAGGCCCTGGAGGAGAAAG GACGGCAGATCCTGATGAAAGACAACCTGATCGATGAGGAGCTGGCCAGGGCGGGCGCGG ACCCCAAGGACCTTGAGGAGAAAGTGGAGCAGCTGGGGTCCTCCCTGGACACCCTGCAGA CCAGGTTTGCACGCCTCCTGGCTGAGTACAACGCCACCCAGATGAAGATGAAGCAGCGTC TCAGCCAACTGGAAAGCCAGGTGAAGGGTGGTGGGGACAAGCCCCTGGCTGATGGGGAAG TTCCCGGGGATGCTACAAAAACAGAGGACAAACAACAGTGAAAATGCAGCATCTGTCTCC TGCTTCACAGGGTCGACTGTCAGGGTGACCGTATGTGGCCGCAGCTGTGTGGCATGGAAC TTGGTCAGGG TTGAATTCCAGCTCTACTCACCCTTTGAAAGCTGTGTGACTGCCTGAGAG AACCTGTTTCTTCACCTAAAAAATGGGACTTTTTGTCTCAGTCCCAGTGAAGTGCCAGGT TTGATTGTGAAGTCCGCATGAAACACTGCACCAGGCAGGGCTTTGCAAAGTGCAAGGTAT CCCCAGTCCAAGTATATGAAAACGTGCACACAGGACTCTCATTACTTTTTTATGGAATCT GCAAGGTGTTTTTAGGCTTTTTAATCTGATTTTCTTATAAATGAAAGATTATTTAGTC AC CTTTCTCCTGTCCAACTTCACCACCACCTGATAATGGGTATATAACAGGAAGCTGAAGGT ACAACATAGTGACTAAAATTCAGACTTACACAAGACAGTTTGAGGCATATTTCTTAATCT GGTATCACCTCGTGTGTTCTTTGGGGCCCTAGAAACCCTGGCTTTTGGGAGTGCTATGGC AAGTAGAAGTTCTGCCGGATGGAAAGAGGCTGCCCCATTTGAGGTCATTTAAAATCTGTG AAGCAAATCCAGACTCCTTGCCGTTCAGCCACTGTGAAACCAGAATCTGCTTCACAGAAA AAAGCATCTCAGTTAGGAGAAGAGACATCCCCTCCTTCTCACTTGCCAAAGAGATTCAAA GACAGCCCCTATCCTCCATTCTTGAGTCAGGGCCCTAGGTGACCTATTCTAACTCAAGGA GGAGAGCTATGTACAGGGAGAGCATTTTAGATTGAAGGTTGGAATGGTGTACTAAACCAA AAAAGCTGACAACTGAGAGTTTTAGAAGATTAGACCATTAGGAACGTATCTTTGCAAACT GCCCATTCACCCATGAAGAGGAAGCCTCAAGATCCCTTGGAATTGCATCCCAAGGCAAAG CTTTTGGCTCACCGAAAGCTCACAGATTGCAGAAATTAGCTTTTTTAAAAAACAAACCCC AGTAAATATAATTTCATTAACATTTTATAACAGATTTATATTTTTGAGTTCCGTGATTGC AAATTATGACCTCAAATTCCATCCTTCACTTATGTAACATGTTGCAAATTACCCAAAGAT GAGTCTTTCTTCTTTCTTTCCTTTTTCCTTTCTTCTTCCTTTCCTTTTTTCTTTCTTCTT CCTTCTTTCTTCCTTTTTCTCTCTCCTCTTTTCCTCCTCAAAATGTATATATTTTAAAAG CCTTAACTGTTAGTTATGCCTGCATTCATATTTGCACAGGAAAAATAAAGACCTGGATTT AAAAATA (2758 п.н.)

мРНК join(1..380,23785..23922,31533..31646,34021..34200, 37234..37287,43504..43620,45710..45816,49690..52447)

Основные гены глазных заболеваний:

ABCA4
AIPL1
BCOR
BEST1
CABP4
CACNA1F
CDH23
CEP290
CERKL
CHM
CLRN1
CNGA1
CNGA3
CNGB3
CRB1
CRX
CYP1B1
DFNB31 (WHRN)
EDNRB
ELOVL4
EYS
FOXC1
FOXE3
FRMD7
FZD4
GNAT1
GPR98
GPR143
GRM6
GUCA1A
GUCY2D
HESX1
IMPDH1
LCA5
LRAT
LRP5
MYO7A
MYOC
NDP
NR2E3
NYX
OPTN
OTX2
PAX3
PAX6
PCDH15
PDE6A
PDE6B
PITX2
PRPF3
PRPF8
RAX, RB1
RDH5
RDS (PRPH2)
RHO
RLBP1
RP2
RPE65
SAG
SOX2
SOX10
STRA6
TRPM1
TSPAN12
TYR
USH1C
USH1G
USH2A
VSX2(CHX10) WDR36
XLRS1 (RS1)

 
 
 
  Как собирать образцы для генетического анализа
Как собирать образцы для генетического анализа
 
  ДНК диагностика глазных болезней в России и СНГ
Мы работаем в России и странах СНГ
 
  Как проводится генетическая диагностика в офтальмологии
Как проводится ген.диагностика
 
  Цены на ДНК диагностику глазных болезней
Из чего складывается цена анализа?
 
  Как правильно рисовать генеалогическое дерево
Как правильно составлять историю здоровья семьи?
 
  секвенирование нового поколения
Используемые нами технологии
 
  клинические признаки при генетической диагностике
Необходимые для ген.анализа клинические данные
 
  Organum visus Голубев Сергей Юрьевич
Информационный партнер проекта
 
  Профессионально о зрении портал OD OS
Информационный партнер проекта
 
 
Copyright © Офтальмик 2008 - 2017